|
Genecopoeia
wave2/wasf2 rabbit mab Wave2/Wasf2 Rabbit Mab, supplied by Genecopoeia, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2/wasf2 rabbit mab/product/Genecopoeia Average 95 stars, based on 1 article reviews
wave2/wasf2 rabbit mab - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
unlabeled wave2 mouse c ![]() Unlabeled Wave2 Mouse C, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/unlabeled wave2 mouse c/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
unlabeled wave2 mouse c - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
α wave2 ![]() α Wave2, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/α wave2/product/Cell Signaling Technology Inc Average 95 stars, based on 1 article reviews
α wave2 - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Millipore
wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc Wave2 3 † Aucagggugaggugggaaagauggg Uagucccacuccacccuuucuaccc, supplied by Millipore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc/product/Millipore Average 90 stars, based on 1 article reviews
wave2 3 † aucagggugaggugggaaagauggg uagucccacuccacccuuucuaccc - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
wave2 antibody Wave2 Antibody, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2 antibody/product/Cell Signaling Technology Inc Average 94 stars, based on 1 article reviews
wave2 antibody - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
wave2 d2c8 antibodies ![]() Wave2 D2c8 Antibodies, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2 d2c8 antibodies/product/Cell Signaling Technology Inc Average 92 stars, based on 1 article reviews
wave2 d2c8 antibodies - by Bioz Stars,
2026-03
92/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
rabbit polyclonal anti-wave2 antibody (cat#: 3659) ![]() Rabbit Polyclonal Anti Wave2 Antibody (Cat#: 3659), supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/rabbit polyclonal anti-wave2 antibody (cat#: 3659)/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
rabbit polyclonal anti-wave2 antibody (cat#: 3659) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
goat anti wave2 polyclonal antibody ![]() Goat Anti Wave2 Polyclonal Antibody, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/goat anti wave2 polyclonal antibody/product/Santa Cruz Biotechnology Average 96 stars, based on 1 article reviews
goat anti wave2 polyclonal antibody - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
2004 2236 1 wave3 rabbit igg ![]() 2004 2236 1 Wave3 Rabbit Igg, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/2004 2236 1 wave3 rabbit igg/product/Cell Signaling Technology Inc Average 95 stars, based on 1 article reviews
2004 2236 1 wave3 rabbit igg - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Proteintech
anti wave 2 ![]() Anti Wave 2, supplied by Proteintech, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti wave 2/product/Proteintech Average 95 stars, based on 1 article reviews
anti wave 2 - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
wave2 h110 ![]() Wave2 H110, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wave2 h110/product/Santa Cruz Biotechnology Average 90 stars, based on 1 article reviews
wave2 h110 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
anti-βactin ![]() Anti βactin, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/anti-βactin/product/Cell Signaling Technology Inc Average 90 stars, based on 1 article reviews
anti-βactin - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Frontiers in cell and developmental biology
Article Title: Ena/VASP proteins at the crossroads of actin nucleation pathways in dendritic cell migration.
doi: 10.3389/fcell.2022.1008898
Figure Lengend Snippet: FIGURE 6 The VASP-EVH1 domain interacts with Wave2 and mDia1 in DCs. (A) Domain structure of Ena/VASP proteins and derived GST-fusion protein. EVH1, Ena/VASP homology 1 domain; EVH2, Ena/VASP homology 2 domain; PRR, Proline-rich region; GAB, G-actin binding site; FAB, F-actin binding site; GST: Glutathione S-transferase; FPPPP, Pro-rich motif recognized by EVH1 domain. (B–D) Recombinant GST-VASP-EVH1 and GST as control were purified from bacteria with GST-beads and incubated with detergent-extracted lysate of immature or mature DCs in the presence or absence of an EVH1-specific inhibitor. After thorough washing, proteins were eluted and analyzed by mass spectrometry (B,C) or by immunoblotting with the indicated antibodies (D). Volcano plots illustrate the inhibitor-sensitive hits obtained by mass spectrometry for iDCs (B) and mDCs (C). (D) Immunoblotting confirms that Abi1 and Wave2 (as representatives of the WRC) and mDia1 from iDCs and mDCs show specific binding to the EVH1 domain of VASP which is inhibited by the EVH1 domain-specific inhibitor.
Article Snippet: Antigen Species Clone name or catalog # Supplier IF WB FACS Comments α-Tubulin Mouse DM1A Cell signalling -- 1:500 -- unlabeled β-Actin Mouse Ac-15; A5441 Sigma-Aldrich -- 1:1,000 -- unlabeled CD11c Hamster N418; MCD11c05 Thermo Fisher Scientific -- -- 1:400 APC-labeled CD40 Mouse 3/23; #562846 BD Biosciences -- -- 1:400 Pacific Blue-labeled CD86 Rat GL1 eBioscience -- -- 1:100 APC-labeled EVL Rabbit TA343847 Origene -- 1:500 -- unlabeled GAPDH Mouse G8795 Sigma -- 1:1,000 -- unlabeled mDia1 Rabbit Ab129167; Ab96784 Abcam -- 1:1,000 -- unlabeled mDia1 Mouse Clone 51; 610,848 BD Biosciences 1:50 -- -- unlabeled Lamellipodin Rabbit -- Matthias Krause, Kings College London -- 1:20,000 -- unlabeled Mena Rabbit LS-C170270 LSBio -- 1:500 -- unlabeled p34/ARPC2 Rabbit 07-227-I Sigma-Aldrich 1:100 1:1,000 -- unlabeled Paxillin Rabbit Y113; ab32084 Abcam 1:400 -- -- unlabeled VASP Rabbit 9A2 Cell signalling -- 1:500 -- unlabeled Vinculin Mouse V9264 Sigma -- 1:1,000 -- unlabeled Vinculin Rabbit Ab73412 Abcam 1:400 -- -- unlabeled Wave2 Rabbit D2C8 Cell signalling -- 1:500–1:1,000 --
Techniques: Derivative Assay, Binding Assay, Recombinant, Control, Bacteria, Incubation, Mass Spectrometry, Western Blot
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: Small interference RNA (siRNA) and antibodies used in RNA interference experiments in the present study
Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon,
Techniques:
Journal: Cancer Science
Article Title: WAVE2‐ and microtubule‐dependent formation of long protrusions and invasion of cancer cells cultured on three‐dimensional extracellular matrices
doi: 10.1111/j.1349-7006.2008.00927.x
Figure Lengend Snippet: (a–c) Reduction of neural Wiskott–Aldrich Syndrome protein (N‐WASP) or WASP family Verprolin‐homologous protein (WAVE) family proteins by RNA interference in MDA‐MB‐231 cells. Cells were transfected with small interference RNA (siRNA) for 24 h and further cultured for 24 h, then part of the cells was used to extraction of proteins and the rest were plated on 3‐D gel. Western blot analyzes of N‐WASP (a), WAVE family proteins (b) and WAVE2 (c) expression. (d and e) Effect of siRNA on the formation of long protrusions and invasion. Cells transfected with siRNA were cultured on 3‐D gel for 18 h. Results of cells transfected with specific siRNA are normalized to those of cells treated with control siRNA as 100 in each experiment. Averages of the results of repeated experiments (N: number of experiments) are shown with standard deviations (error bars). Asterisks mark the results with P‐values of Student's t‐test less than 0.05. (f) Effect of siRNA on the formation of invadopodia. Cells transfected with siRNA for 48 h were plated onto Oregon Green 488 conjugated‐gelatin film and cultured for 18 h. The cells with one or more sites in which focally degraded‐gelatin and a punctate aggregate of F‐actin were judged to form invadopodia. Averages of the results of four independent experiments are shown with standard deviations (error bars). P‐values of Student's t‐test for the difference between the results with control siRNA and either N‐WASP or WAVE2 siRNA are noted in the figure. Those with control siRNA and siRNA for WAVE1 or WAVE3 exceeded 0.1.
Article Snippet: Table 1 Target siRNA Antibody for detection of protein N‐WASP GAAAUGUGUGACUAUGUCUTT TTCUUUACACACUGAUACAGA Cell signaling, rabbit MAb (30D10) WAVE1 UCCUUCGUAUUUCUUUGAUTT TTAGGAAGCAUAAAGAAACUA Santa Cruz, goat pAb (L‐19) WAVE2‐1 † AAACCAGAUCCUCUUUGGUUGUCCA UUUGGUCUAGGAGAAACCAACAGGU Chemicon, rabbit pAb (AB4226) WAVE3 CUUCUACAUCAGAGCAAAUTT TTGAAGAUGUAGUCUCGUUUA Santa Cruz, goat pAb (N‐16) WAVE2‐2 † UAUCAUUGGAGGCGGAGGUGGCGGA AUAGUAACCUCCGCCUCCACCGCCU Chemicon,
Techniques: Transfection, Cell Culture, Extraction, Western Blot, Expressing
Journal: eLife
Article Title: Actin foci facilitate activation of the phospholipase C-γ in primary T lymphocytes via the WASP pathway
doi: 10.7554/eLife.04953
Figure Lengend Snippet: ( A ) TCR-induced recruitment of NWASP and WAVE2 to IS. Mouse primary WT CD4 T cells were incubated with bilayer containing ICAM1 alone (−) or both ICAM1 and anti-CD3 (+) for 2 min at 37°C, fixed and immunostained for endogenous proteins. Stained cells were visualized using TIRF microscopy. The graph shows quantitation of antibody fluorescence at IS, where each point represents the value obtained from a single cell. n1 = 16, n2 = 54 (for WAVE2), n3 = 16, n4 = 78 (for NWASP); p1, p2 < 0.0001 . Each point represents average levels of indicated protein at synapse in a single cell. ( B ) The images shown are TIRF plane distributions of the indicated proteins. As elaborated in the magnified areas marked with white boundary in original ‘merge’ image, there is a lack of co-localization between either of these proteins and TCR MCs. Scale bar, 5 μm. Insets in ( B ) have been intensity scaled differently from original ‘Merge’ panel to highlight protein distribution with more clarity. DOI: http://dx.doi.org/10.7554/eLife.04953.007
Article Snippet: HS1 antibody (D5A9), Phospho-Y397 HS-1 antibody (D12C1), phospho-Y319 Zap70/Y352 Syk (affinity purified antisera #2704), PLCγ1 (D9H10), phospho-Y783 PLCγ1 (#2821), NFAT1 (D43B1), phospho-Y416 SFK (#6943), phospho-Y171 LAT (#3581) and
Techniques: Incubation, Staining, Microscopy, Quantitation Assay, Fluorescence
Journal: eLife
Article Title: Actin foci facilitate activation of the phospholipase C-γ in primary T lymphocytes via the WASP pathway
doi: 10.7554/eLife.04953
Figure Lengend Snippet: Human CD4 T cells were incubated with culture media containing lentiviral particles carrying WASP shRNA or non-specific (control) shRNA for 48 hr ( A ) T cells transduced with WASP shRNA or control shRNA carrying lentiviral particles were incubated with endothelial monolayer for 10 min, fixed and processed for Alexa594-phalloidin (pseudo-colored green) and phospho-HS1 (pseudo-colored red) immuno-staining. The conjugates were then imaged using an EMCCD-coupled spinning disc confocal microscope. Each image represents a single confocal plane of T cell synapse, where the planar endothelial interface is in focus. The area outlined in ‘merge’ panels was further scaled and magnified to show the details with more clarity (bottom panels). The top panels show the image of the field of view in DIC (left image) or fluorescence settings. ( B ) A reduction in WASP levels results in defective phospho-HS1 accumulation at T cell-endothelial cell synapse. The upper graph shows quantitation of phalloidin intensity in the synaptic plane, while the lower graph shows phospho-HS1 levels in the same plane. For both the upper and lower graphs, n1 = 68, n2 = 29, p1 = 0.071, p2 < 0.0001 . This experiment was repeated twice with similar results. ( C ) Model of temporal sequence of events leading to F-actin foci formation and PLCγ signaling at the immunological synapse. Multiple pathways can result in actin polymerization and remodeling at the synaptic interface, contributing to F-actin organization in different SMAC zones. One such pathway involves WAVE2 recruitment by activated LFA1, followed by WAVE2 dependent Arp2/3 complex activation resulting in thick lamellipodial (dSMAC) and lamellar (pSMAC) F-actin meshworks. WAVE2-dependent F-actin pool is required for calcium-dependent calcium entry via the CRAC channel. Additional pathways including MyosinII-mediated actin remodeling is required for maintaining lamellar actin flow and directional persistence of microclusters (MCs) towards the cSMAC, and formin-mediated nucleation of F-actin promotes MTOC docking and stability of synapse. Another pool of F-actin or ‘F-actin foci’ is generated by the activity of WASP protein in the p- and dSMAC zones. Following TCR triggering, WASP is recruited at TCR signalosome via several possible mechanisms – such as via Vav, via NCK, via Zap70 and CrkL mediated WIP release and other effector mechanisms, and, through Fyn or PIP2 or PTP-PEST-binding at the plasma membrane (PM). Once activated, WASP recruits Arp2/3 complex to the MC, which then leads to actin branch nucleation and polymerization at the MC, over and above the local background actin. This process continues even during MC movement in the lamellar region, with a high F-actin turnover at the foci until its delivery to the cSMAC. In the foci, HS1 is recruited via binding both the Arp2/3 complex as well as F-actin, and is subsequently phosphorylated. As a consequence of early TCR signaling, PLCγ1 is also recruited to the MC signalosome, where it is stabilized via interactions with both F-actin, and foci residing HS1. F-actin foci dynamics in the proximity of the plasma membrane further support PLCγ1 phosphorylation, potentially by facilitating its interaction with PM-bound, upstream activators such as Itk. Phosphorylation of PLCγ1 by Itk then triggers phosphoinositide signaling, which in turn initiates calcium ion flux and NFAT1 activation. WASP deficiency or failure to activate Arp2/3 complex by WASPΔC mutant leads to selective loss of nucleation of foci at the MC. As a result, early signaling is not affected, however, both HS1 and PLCγ1 levels are severely reduced at the microcluster sites. The remaining PLCγ1 at synapse allows cell spreading and synapse formation, however, it is not sufficient to achieve calcium flux comparable to the control cells. Direct pharmacological inhibition of Arp2/3 complex using CK666 yields similar results; early TCR signaling is preserved while PLCγ1 phosphorylation and late signaling are severely perturbed. As actin polymerizing processes other than WASP also utilize Arp2/3 Complex, CK666-treated cells show a general reduction in lamellipodial and lamellar actin as well. However, the remaining F-actin levels are sufficient to support early TCR signaling. In contrast, total F-actin depolymerization at the synapse using CytochalasinD results in defects in early as well as late signaling, as has been reported in earlier studies. The image on the bottom shows a maximum intensity projection of synaptic contact interface of a human primary CD4 T cell, acquired using spinning disc confocal microscope. This cell was activated on a bilayer reconstituted with Alexa568 tagged anti-CD3 (red) and ICAM1 (unlabeled), for 2 min, fixed and stained for F-actin (green), and imaged. DOI: http://dx.doi.org/10.7554/eLife.04953.031
Article Snippet: HS1 antibody (D5A9), Phospho-Y397 HS-1 antibody (D12C1), phospho-Y319 Zap70/Y352 Syk (affinity purified antisera #2704), PLCγ1 (D9H10), phospho-Y783 PLCγ1 (#2821), NFAT1 (D43B1), phospho-Y416 SFK (#6943), phospho-Y171 LAT (#3581) and
Techniques: Incubation, shRNA, Control, Transduction, Immunostaining, Microscopy, Fluorescence, Quantitation Assay, Sequencing, Activation Assay, Generated, Activity Assay, Binding Assay, Clinical Proteomics, Membrane, Phospho-proteomics, Mutagenesis, Inhibition, Staining
Journal: Cell Cycle
Article Title: SKAP2 regulates Arp2/3 complex for actin-mediated asymmetric cytokinesis by interacting with WAVE2 in mouse oocytes
doi: 10.1080/15384101.2017.1380126
Figure Lengend Snippet: Effects of SKAP2 RNAi on ARP2 and WAVE2 expression. (A) Subcellular localization of ARP2 after SKAP2 siRNA injection. ARP2 was mainly distributed at the membrane in the control oocytes, whereas ARP2 expression was barely detectable in the siRNA-injected group. Green: ARP2; blue: chromatin. Bar = 20 μm. (B) Localization of WAVE2 after SKAP2 siRNA injection. WAVE2 was expressed around the spindle, whereas no specific localization of WAVE2 was observed around spindle in the siRNA-injected group. Red: WAVE2; blue: chromatin. Bar = 20 μm. (C) The fluorescence intensity of ARP2 in the SKAP2 siRNA-injected oocytes was decreased. (D) The fluorescence intensity of WAVE2 in SKAP2 siRNA-injected oocytes was significantly reduced. (E) ARP2 expression was reduced after SKAP2 siRNA injection by western blotting examination, as the relative intensity of ARP2 protein was significantly decreased. (F) WAVE2 expression was decreased after SKAP2 siRNA injection by western blotting analysis, as the relative intensity of WAVE2 protein was significantly reduced. *: significant difference (P < 0.05).
Article Snippet:
Techniques: Expressing, Injection, Fluorescence, Western Blot
Journal: Journal of Biological Chemistry
Article Title: Dysbindin-1C Is Required for the Survival of Hilar Mossy Cells and the Maturation of Adult Newborn Neurons in Dentate Gyrus
doi: 10.1074/jbc.m114.590927
Figure Lengend Snippet: FIGURE 1. Dysbindin-1A and -1C have distinct spatial and temporal expression patterns and dysbindin-1C is not a subunit of the BLOC-1 complex. Tissue extracts from DBA/2J mice were subjected to SDS-PAGE followed by Western blotting using anti-dysbindin-1 antibody. The brain extract from sdy was used as a negative control, and -actin was used as a loading control. These experiments were repeated three times independently. A, dysbindin-1A is widely expressed in multiple mouse tissues, whereas dysbindin-1C is only expressed in the brain and spinal cord. B, in brain sub-regions, the dysbindin-1A levels are higher than dysbindin-1C in the olfactory bulb, substantia nigra, cerebellar cortex, and brain stem, but dysbindin-1C has higher expression levels than dysbindin-1A in the striatum, cerebral cortex, and hippocampal formation. C, dysbindin-1C is mainly enriched in the synaptic vesicles, whereas dysbindin-1A is mainly localized in the presynaptic membrane. In addition, both dysbindin-1A and -1C are found in the proportion of postsynaptic density. Successful synaptic fractionation is confirmed with VAMP2 as a marker for synaptic vesicles and GluR1 as a marker for the postsynaptic density. D and E, protein levels of dysbindin-1A in the hippocampal formation are gradually decreased. In contrast, the dysbindin-1C expression levels increase at postnatal stages. The chart in E is plotted by the relative intensities (IOD) of the bands in D. F, sedimentation velocity analyses. Mouse brain cytosol was fractioned by ultracentrifugation on a 5–20% (w/v) sucrose gradient and probed with antibodies against dysbindin-1, BLOS1, -dystrobrevin, and WAVE2 by immunoblotting. Fractions 1 and 20 correspond to the top and bottom ends of the gradient, respectively. Dysbindin-1C does not co-sediment with subunits of the BLOC-1 complex, including dysbindin-1A and BLOS1. Moreover, dysbindin-1C does not form a stable DPC complex with -dystrobrevin nor a stable ternary complex with WAVE2 and Abi-1. Arrowheads, nonspecific bands. G, destabilization of the dysbindin-1 in extracts of three BLOC-1 mutants (sdy, pa, and mu). Sdy is the mutant of dysbindin-1; mu is the mutant of muted; and pa is the mutant of pallidin. Inbred strain DBA/2J served as the control for sdy, CHMU/Le for mu, and C57BL/6J for pa.
Article Snippet: Other antibodies used in this study were as follows:
Techniques: Expressing, SDS Page, Western Blot, Negative Control, Control, Membrane, Fractionation, Marker, Sedimentation, Mutagenesis
Journal: Oncotarget
Article Title: Stimulus-dependent dissociation between XB130 and Tks5 scaffold proteins promotes airway epithelial cell migration.
doi: 10.18632/oncotarget.13261
Figure Lengend Snippet: Figure 3: Stimulus-dependent translocation of endogenous XB130 and Tks5 to the cell membrane indicates distinct signaling roles. A. Immunoblots of cytoplasm (C) and membrane (M) fractionated BEAS-2B cell lysates. Cells were treated with or without 50 ng/mL EGF, 500 nM PDBu or 0.1 μM NNK. XB130 and WAVE2 expression and translocation from the cytoplasm to the cell membrane are more dependent on EGF stimulation, whereas, Tks5 and N-WASP expression and translocation are more dependent on PDBu and NNK stimulation. B. Ratio of normalized membrane expression to normalized cytoplasm expression. Expression of Na+/K+ ATPase was used to normalize membrane fractions and expression of GAPDH was used to normalize cytoplasmic fractions. Data is summarized from three independent experiments and presented as mean ± SD. * represents p < 0.01 compared to the corresponding no treatment group.
Article Snippet: Small interfering RNA (siRNA) targeting human AFAP1L2, human Tks5 and control siRNA and rabbit anti-N-WASP (H100) (1:750),
Techniques: Translocation Assay, Membrane, Western Blot, Expressing
Journal: Oncotarget
Article Title: Stimulus-dependent dissociation between XB130 and Tks5 scaffold proteins promotes airway epithelial cell migration.
doi: 10.18632/oncotarget.13261
Figure Lengend Snippet: Figure 4: XB130 colocalizes robustly with WAVE2 at lamellipodia but not at podosomes with N-WASP, after stimulation. A.-B. Co-immunofluorescence staining of XB130 (green), actin (blue) and either WAVE2 (A) or N-WASP (B) (red). BEAS2B cells were treated with or without 50 ng/mL EGF, 500 nM PDBu or 0.1 μM NNK. No treatment control shows normal stress fibers. Stimulation with EGF, PDBu and NNK produces actin-rich ruffled areas at the cell membrane, which are indicative of lamellipodia via WAVE2 staining (A). These areas are also enriched with XB130 (A and B). PDBu and NNK induce formation of podosomes (white arrows) which are enriched by N-WASP but not XB130 (B ). D. Mander’s overlap co-efficient (MOC) of the cell periphery displays the relative colocalization of XB130 with WAVE2, Tks5 or N-WASP, where 0 represents no colocalization and 1 represents perfect colocalization. XB130 colocalizes robustly with WAVE2 at the lamellipodia and to a lesser extent with Tks5 and N-WASP, indicating it translocates to and is involved in lamellipodia formation. Data is summarized from 10 different cells per group from 3 different experiments and presented as mean ± SD. * represents p < 0.01 for XB130/N-WASP and XB130/Tks5 MOCs compared to XB130/WAVE2 MOCs.
Article Snippet: Small interfering RNA (siRNA) targeting human AFAP1L2, human Tks5 and control siRNA and rabbit anti-N-WASP (H100) (1:750),
Techniques: Immunofluorescence, Staining, Control, Membrane
Journal: Oncotarget
Article Title: Stimulus-dependent dissociation between XB130 and Tks5 scaffold proteins promotes airway epithelial cell migration.
doi: 10.18632/oncotarget.13261
Figure Lengend Snippet: Figure 8: Schematic diagram of the role of XB130 and Tks5 in Rac1 and Cdc42-associated cytoskeletal remodeling for lung epithelial cell migration. Cell migration requires cytoskeleton remodeling mediated by the Arp2/3 complex, which results in the formation of branched, F-actin rich structures (red ball and sticks), such as lamellipodia and podosomes. This diagram shows the A. Top- down view and B. Side-view of a cell displaying lamellipodia and podosome. We demonstrated a novel mechanism for lung epithelial cell migration, in which extracellular factors stimulate a sub-population of XB130 to dissociate from Tks5 and translocate to the cell periphery to promote Rac1-activated signaling of WAVE2-associated lamellipodia formation for cell extension and Tks5 mediation of Cdc42 activity via PAK1 interaction for the promotion of N-WASP-associated podosome assembly and function for ECM-dependent cell migration. Dashed black lines represent translocation of XB130 and Tks5 to the cell membrane.
Article Snippet: Small interfering RNA (siRNA) targeting human AFAP1L2, human Tks5 and control siRNA and rabbit anti-N-WASP (H100) (1:750),
Techniques: Migration, Activity Assay, Translocation Assay, Membrane